In this article, we are going to implement two functions. The first function will count G and C nucleotides (GC Content) in a string, and the second function will use the first function but allow us to specify a ‘window’ size to calculate GC content in.
Here is a Wikipedia excerpt on GC Content:
In molecular biology and genetics, GC-content (or guanine-cytosine content) is the percentage of nitrogenous bases in a DNA or RNA molecule that are either guanine (G) or cytosine (C).[1] This measure indicates the proportion of G and C bases out of an implied four total bases, also including adenine and thymine in DNA and adenine and uracil in RNA.
GC-content may be given for a certain fragment of DNA or RNA or for an entire genome. When it refers to a fragment, it may denote the GC-content of an individual gene or section of a gene (domain), a group of genes or gene clusters, a non-coding region, or a synthetic oligonucleotide such as a primer.
A Wiki link: https://en.wikipedia.org/wiki/GC-content
A discussion link: https://www.researchgate.net/post/GC_content_in_DNA
So open our dna_toolkit.py file and add the first function:
def gc_content(seq):
"""GC Content in a DNA/RNA sequence"""
return round((seq.count('C') + seq.count('G')) / len(seq) * 100)This is a very simple function as we only use built-in Python functionality. We search for character ‘C’ and ‘G’ using the count() method of the sequence we pass to this function (seq). Then we use the most basic calculation to get the percentage (%). Basically: the amount of G and C, divided by the length of the whole sequence (seq) and then multiplied by a 100 to get %.
So if we pass “ATCG” to our function, we should get 50% back, if we pass “ATCA”, we get 25% back, and we get 75% if we pass “AGCG” for example.
Now, what if we want to count GC content in sub-areas of a DNA sequence? Let’s say we are interested in ‘window’ size 3:
window = 3 seq = "CGATGAATCTATA"
So we would have something like that:
[CGA]TGAATCTATA = 67%
CGA[TGA]ATCTATA = 33%
CGATGAA[TCT]ATA = 33%
CGATGAATCTA[TAA] = 0%
def gc_content_subsec(seq, k=5):
"""
GC Content in a DNA/RNA sub-sequence length k.
k=20 by default
"""
res = []
for i in range(0, len(seq) - k + 1, k):
subseq = seq[i:i + k]
res.append(gc_content(subseq))
return resWe are using our original gc_content() (line 9) function, and we are adding a bit of logic on top of that to handle the ‘window’, which we call ‘k‘ and we set it to 5 by default, just in case if you forget to pass k to our function.
Our for loop makes sure we scan the whole sequence and make k (5 by default) jumps, to replicate the example above. We use string slicing to grab only the part of the string we need, which, again, is of size k (our window). And we accumulate results in a list res.
So now if we run this on another test DNA string: “ATATGATAGATAGCCCAGTCCGT“, and a window size 5, we should have this output:
[20, 20, 60, 60]
Alright. Now we have our two new functions working, let’s add a proper output to our main.py file and run the whole thing:
print(f'[5] + GC Content: {gc_content(DNAStr)}%\n')
print(f'[6] + GC Content in Subsection k=5: {gc_content_subsec(DNAStr, k=5)}\n')If we run our main.py file now, we should see something like this:
Sequence: CTGTCCTTCTCATCTACGGTGATTCCAATGTGGTACATTGCGCTTTTTCA
[1] + Sequence Length: 50
[2] + Nucleotide Frequency: {'A': 8, 'C': 13, 'G': 9, 'T': 20}
[3] + DNA/RNA Transcription: CUGUCCUUCUCAUCUACGGUGAUUCCAAUGUGGUACAUUGCGCUUUUUCA
[4] + DNA String + Complement + Reverse Complement:
5' CTGTCCTTCTCATCTACGGTGATTCCAATGTGGTACATTGCGCTTTTTCA 3'
||||||||||||||||||||||||||||||||||||||||||||||||||
3' GACAGGAAGAGTAGATGCCACTAAGGTTACACCATGTAACGCGAAAAAGT 5' [Complement]
5' TGAAAAAGCGCAATGTACCACATTGGAATCACCGTAGATGAGAAGGACAG 3' [Rev. Complement]
[5] + GC Content: 44%
[6] + GC Content in Subsection k=5: [60, 40, 40, 60, 40, 40, 40, 40, 60, 20]This is it for this article. Feel free to watch a video version below, join our bioinformatics community and leave a comment below:
great insightful information