<?xml version="1.0" encoding="UTF-8"?><rss version="2.0" xmlns:content="http://purl.org/rss/1.0/modules/content/"><channel><title>REBELSCIENCE</title><link>https://rebelscience.club/</link><description>Bioinformatics, Programming and Open-Source Science</description><item><title>DNA Toolkit Part 4: Translation, Codon Usage</title><link>https://rebelscience.club/2020/04/dna-toolkit-part-4-translation-codon-usage/</link><guid isPermaLink="true">https://rebelscience.club/2020/04/dna-toolkit-part-4-translation-codon-usage/</guid><pubDate>Sun, 05 Apr 2020 13:46:53 GMT</pubDate><description>In this article we are taking a look at DNA Codon table and adding a Translation and Codon Usage functions to our DNA Toolkit.
</description><content:encoded><![CDATA[
<p class="wp-block-paragraph">Before we take a look at a <a rel="noreferrer noopener" href="https://en.wikipedia.org/wiki/Translation_(biology)" target="_blank">Translation</a> function, we need to create a structure to hold the DNA/RNA codon table. We will use a Python dictionary as it is just perfect for holding multiple Keys, that have the same value. Let&#8217;s add this to our <code>structures.py</code> file:</p>


<div class="wp-block-codemirror-blocks-code-block code-block"><pre class="CodeMirror" data-setting="{&quot;showPanel&quot;:true,&quot;languageLabel&quot;:&quot;language&quot;,&quot;fullScreenButton&quot;:true,&quot;copyButton&quot;:true,&quot;mode&quot;:&quot;python&quot;,&quot;mime&quot;:&quot;text/x-python&quot;,&quot;theme&quot;:&quot;monokai&quot;,&quot;lineNumbers&quot;:true,&quot;styleActiveLine&quot;:false,&quot;lineWrapping&quot;:false,&quot;readOnly&quot;:true,&quot;fileName&quot;:&quot;Python&quot;,&quot;align&quot;:&quot;wide&quot;,&quot;language&quot;:&quot;Python&quot;,&quot;maxHeight&quot;:&quot;400px&quot;,&quot;modeName&quot;:&quot;python&quot;}">DNA_Codons = {
    # 'M' - START, '_' - STOP
    &quot;GCT&quot;: &quot;A&quot;, &quot;GCC&quot;: &quot;A&quot;, &quot;GCA&quot;: &quot;A&quot;, &quot;GCG&quot;: &quot;A&quot;,
    &quot;TGT&quot;: &quot;C&quot;, &quot;TGC&quot;: &quot;C&quot;,
    &quot;GAT&quot;: &quot;D&quot;, &quot;GAC&quot;: &quot;D&quot;,
    &quot;GAA&quot;: &quot;E&quot;, &quot;GAG&quot;: &quot;E&quot;,
    &quot;TTT&quot;: &quot;F&quot;, &quot;TTC&quot;: &quot;F&quot;,
    &quot;GGT&quot;: &quot;G&quot;, &quot;GGC&quot;: &quot;G&quot;, &quot;GGA&quot;: &quot;G&quot;, &quot;GGG&quot;: &quot;G&quot;,
    &quot;CAT&quot;: &quot;H&quot;, &quot;CAC&quot;: &quot;H&quot;,
    &quot;ATA&quot;: &quot;I&quot;, &quot;ATT&quot;: &quot;I&quot;, &quot;ATC&quot;: &quot;I&quot;,
    &quot;AAA&quot;: &quot;K&quot;, &quot;AAG&quot;: &quot;K&quot;,
    &quot;TTA&quot;: &quot;L&quot;, &quot;TTG&quot;: &quot;L&quot;, &quot;CTT&quot;: &quot;L&quot;, &quot;CTC&quot;: &quot;L&quot;, &quot;CTA&quot;: &quot;L&quot;, &quot;CTG&quot;: &quot;L&quot;,
    &quot;ATG&quot;: &quot;M&quot;,
    &quot;AAT&quot;: &quot;N&quot;, &quot;AAC&quot;: &quot;N&quot;,
    &quot;CCT&quot;: &quot;P&quot;, &quot;CCC&quot;: &quot;P&quot;, &quot;CCA&quot;: &quot;P&quot;, &quot;CCG&quot;: &quot;P&quot;,
    &quot;CAA&quot;: &quot;Q&quot;, &quot;CAG&quot;: &quot;Q&quot;,
    &quot;CGT&quot;: &quot;R&quot;, &quot;CGC&quot;: &quot;R&quot;, &quot;CGA&quot;: &quot;R&quot;, &quot;CGG&quot;: &quot;R&quot;, &quot;AGA&quot;: &quot;R&quot;, &quot;AGG&quot;: &quot;R&quot;,
    &quot;TCT&quot;: &quot;S&quot;, &quot;TCC&quot;: &quot;S&quot;, &quot;TCA&quot;: &quot;S&quot;, &quot;TCG&quot;: &quot;S&quot;, &quot;AGT&quot;: &quot;S&quot;, &quot;AGC&quot;: &quot;S&quot;,
    &quot;ACT&quot;: &quot;T&quot;, &quot;ACC&quot;: &quot;T&quot;, &quot;ACA&quot;: &quot;T&quot;, &quot;ACG&quot;: &quot;T&quot;,
    &quot;GTT&quot;: &quot;V&quot;, &quot;GTC&quot;: &quot;V&quot;, &quot;GTA&quot;: &quot;V&quot;, &quot;GTG&quot;: &quot;V&quot;,
    &quot;TGG&quot;: &quot;W&quot;,
    &quot;TAT&quot;: &quot;Y&quot;, &quot;TAC&quot;: &quot;Y&quot;,
    &quot;TAA&quot;: &quot;_&quot;, &quot;TAG&quot;: &quot;_&quot;, &quot;TGA&quot;: &quot;_&quot;
}</pre></div>


<p class="wp-block-paragraph">We are going to use a short, one letter notation instead of a three letter notation, but you can change that for your protect if needed. You could also add a switch to your function to choose which notation you want. <br><br><code>M</code> will be a Start codon and <code>_</code> will be a Stop codon.</p>



<p class="wp-block-paragraph">A link to a <code>structures.py</code> file on GitHub <a rel="noreferrer noopener" href="https://github.com/rebelC0der/DNA_Toolkit" target="_blank">here</a>, in a case if you want to copy it.</p>



<p class="wp-block-paragraph">More on codon tables <a href="https://en.wikipedia.org/wiki/DNA_codon_table">here</a>.</p>



<p class="wp-block-paragraph">If you are not familiar with DNA/RNA codons, I suggest watching this video:</p>



<figure class="wp-block-embed is-type-video is-provider-youtube wp-block-embed-youtube wp-embed-aspect-16-9 wp-has-aspect-ratio"><div class="wp-block-embed__wrapper">
<iframe loading="lazy" title="How to Read a Codon Chart" width="640" height="360" src="https://www.youtube.com/embed/LsEYgwuP6ko?feature=oembed" frameborder="0" allow="accelerometer; autoplay; clipboard-write; encrypted-media; gyroscope; picture-in-picture; web-share" referrerpolicy="strict-origin-when-cross-origin" allowfullscreen></iframe>
</div></figure>



<hr class="wp-block-separator has-css-opacity"/>



<p class="wp-block-paragraph">Now let&#8217;s implement a small function, that uses a list comprehension and a <code>for</code> loop to read three nucleotides at a time. Codons are basically nucleotide triplets:</p>



<figure class="wp-block-image size-full"><a href="https://rebelscience.club/wp-content/uploads/2022/12/Screenshot_20221229_103939-2.png"><img decoding="async" width="1022" height="271" src="https://rebelscience.club/wp-content/uploads/2022/12/Screenshot_20221229_103939-2.png" alt="" class="wp-image-1488" srcset="https://rebelscience.club/wp-content/uploads/2022/12/Screenshot_20221229_103939-2.png 1022w, https://rebelscience.club/wp-content/uploads/2022/12/Screenshot_20221229_103939-2-512x136.png 512w, https://rebelscience.club/wp-content/uploads/2022/12/Screenshot_20221229_103939-2-768x204.png 768w, https://rebelscience.club/wp-content/uploads/2022/12/Screenshot_20221229_103939-2-24x6.png 24w, https://rebelscience.club/wp-content/uploads/2022/12/Screenshot_20221229_103939-2-36x10.png 36w, https://rebelscience.club/wp-content/uploads/2022/12/Screenshot_20221229_103939-2-48x13.png 48w" sizes="(max-width: 1022px) 100vw, 1022px" /></a><figcaption class="wp-element-caption">Click to enlarge/download</figcaption></figure>



<p class="wp-block-paragraph">We need to read three nucleotides at a time and match them against our <code>DNA_Codons</code> dictionary, and that will return an amino acid. That way we can build our amino acid chain also called a polypeptide chain that we can try assembling a protein from. We will look at protein assembly in our next article.</p>



<p class="wp-block-paragraph">Let&#8217;s add this function to our <code>dna_toolkit.py</code> file:</p>


<div class="wp-block-codemirror-blocks-code-block code-block"><pre class="CodeMirror" data-setting="{&quot;showPanel&quot;:true,&quot;languageLabel&quot;:&quot;language&quot;,&quot;fullScreenButton&quot;:true,&quot;copyButton&quot;:true,&quot;mode&quot;:&quot;python&quot;,&quot;mime&quot;:&quot;text/x-python&quot;,&quot;theme&quot;:&quot;monokai&quot;,&quot;lineNumbers&quot;:true,&quot;styleActiveLine&quot;:false,&quot;lineWrapping&quot;:false,&quot;readOnly&quot;:true,&quot;fileName&quot;:&quot;Python&quot;,&quot;align&quot;:&quot;wide&quot;,&quot;language&quot;:&quot;Python&quot;,&quot;maxHeight&quot;:&quot;400px&quot;,&quot;modeName&quot;:&quot;python&quot;}">def translate_seq(seq, init_pos=0):
    &quot;&quot;&quot;Translates a DNA sequence into an aminoacid sequence&quot;&quot;&quot;
    return [
        DNA_Codons[seq[pos:pos + 3]]
        for pos in range(init_pos, len(seq) - 2, 3)
    ]</pre></div>


<p class="wp-block-paragraph">If we run this function against this sequence: </p>


<div class="wp-block-codemirror-blocks-code-block code-block"><pre class="CodeMirror" data-setting="{&quot;showPanel&quot;:true,&quot;languageLabel&quot;:&quot;language&quot;,&quot;fullScreenButton&quot;:true,&quot;copyButton&quot;:true,&quot;mode&quot;:&quot;python&quot;,&quot;mime&quot;:&quot;text/x-python&quot;,&quot;theme&quot;:&quot;monokai&quot;,&quot;lineNumbers&quot;:true,&quot;styleActiveLine&quot;:false,&quot;lineWrapping&quot;:false,&quot;readOnly&quot;:true,&quot;fileName&quot;:&quot;Python&quot;,&quot;language&quot;:&quot;Python&quot;,&quot;maxHeight&quot;:&quot;400px&quot;,&quot;modeName&quot;:&quot;python&quot;}">TTGCTAGGATGAGTCGCGAGGTTT</pre></div>


<p class="wp-block-paragraph">List comprehension will generate this:</p>


<div class="wp-block-codemirror-blocks-code-block code-block"><pre class="CodeMirror" data-setting="{&quot;showPanel&quot;:true,&quot;languageLabel&quot;:&quot;language&quot;,&quot;fullScreenButton&quot;:true,&quot;copyButton&quot;:true,&quot;mode&quot;:&quot;python&quot;,&quot;mime&quot;:&quot;text/x-python&quot;,&quot;theme&quot;:&quot;monokai&quot;,&quot;lineNumbers&quot;:true,&quot;styleActiveLine&quot;:false,&quot;lineWrapping&quot;:false,&quot;readOnly&quot;:true,&quot;fileName&quot;:&quot;Python&quot;,&quot;language&quot;:&quot;Python&quot;,&quot;maxHeight&quot;:&quot;400px&quot;,&quot;modeName&quot;:&quot;python&quot;}">TTG - L
CTA - L
GGA - G
TGA - _
GTC - V
GCG - A
AGG - R
TTT - F
['L', 'L', 'G', '_', 'V', 'A', 'R', 'F']</pre></div>


<p class="wp-block-paragraph">This function also has a second parameter, <code>init_pos</code>. This will be used in our future functions when we will be generating reading frames, and allow us to start reading codons from any poison on the DNA string. We will come back to that.</p>



<hr class="wp-block-separator has-css-opacity"/>



<p class="wp-block-paragraph">Now let&#8217;s write a function that computes codon usage, provided an amino acid and a DNA sequence. The result will be a dictionary, where keys will be codons and values will represent the percentage of usage for each of those codons.</p>



<blockquote class="wp-block-quote is-layout-flow wp-block-quote-is-layout-flow">
<p class="wp-block-paragraph">Note that since the genetic code is redundant, there will be repeated values, i.e. a single amino acid will be encoded by different codons. This is normally called the codon usage, and provides interesting statistics when applied to the genes of different species.</p>
<cite>Excerpt from &#8220;<em><a rel="noreferrer noopener" href="https://www.amazon.com/Bioinformatics-Algorithms-Design-Implementation-Python/dp/0128125209" target="_blank">Bioinformatics algorithms. Design and implementation</a></em>&#8221; book.</cite></blockquote>



<p class="wp-block-paragraph">Wikipedia has a very nice article on Codon usage bias <a rel="noreferrer noopener" href="https://en.wikipedia.org/wiki/Codon_usage_bias" target="_blank">here</a>.</p>


<div class="wp-block-codemirror-blocks-code-block code-block"><pre class="CodeMirror" data-setting="{&quot;showPanel&quot;:true,&quot;languageLabel&quot;:&quot;language&quot;,&quot;fullScreenButton&quot;:true,&quot;copyButton&quot;:true,&quot;mode&quot;:&quot;python&quot;,&quot;mime&quot;:&quot;text/x-python&quot;,&quot;theme&quot;:&quot;monokai&quot;,&quot;lineNumbers&quot;:true,&quot;styleActiveLine&quot;:false,&quot;lineWrapping&quot;:false,&quot;readOnly&quot;:true,&quot;fileName&quot;:&quot;Python&quot;,&quot;align&quot;:&quot;wide&quot;,&quot;language&quot;:&quot;Python&quot;,&quot;maxHeight&quot;:&quot;400px&quot;,&quot;modeName&quot;:&quot;python&quot;}">def codon_usage(seq, aminoacid):
    &quot;&quot;&quot;Provides the frequency of each codon encoding a given aminoacid in a DNA sequence&quot;&quot;&quot;
    tmpList = []
    for i in range(0, len(seq) - 2, 3):
        if DNA_Codons[seq[i:i + 3]] == aminoacid:
            tmpList.append(seq[i:i + 3])

    freqDict = dict(Counter(tmpList))
    totalWight = sum(freqDict.values())
    for seq in freqDict:
        freqDict[seq] = round(freqDict[seq] / totalWight, 2)
    return freqDict</pre></div>


<p class="wp-block-paragraph">This function does just three things: scans a sequence and looks for an amino acid we specified, accumulates all found instances in a list, and then calculates a number of found sequences.</p>



<p class="wp-block-paragraph">So let&#8217;s look at the example. If we pass the following DNA sequence to our function:</p>


<div class="wp-block-codemirror-blocks-code-block code-block"><pre class="CodeMirror" data-setting="{&quot;showPanel&quot;:true,&quot;languageLabel&quot;:&quot;language&quot;,&quot;fullScreenButton&quot;:true,&quot;copyButton&quot;:true,&quot;mode&quot;:&quot;python&quot;,&quot;mime&quot;:&quot;text/x-python&quot;,&quot;theme&quot;:&quot;monokai&quot;,&quot;lineNumbers&quot;:true,&quot;styleActiveLine&quot;:false,&quot;lineWrapping&quot;:false,&quot;readOnly&quot;:true,&quot;fileName&quot;:&quot;Python&quot;,&quot;language&quot;:&quot;Python&quot;,&quot;maxHeight&quot;:&quot;400px&quot;,&quot;modeName&quot;:&quot;python&quot;}">seq = TTGCTAGGATGAGTCGCGAGGTTTCTTCACGCCTTTCTTAGTGACTGGTA
aminoacid = 'L'</pre></div>


<p class="wp-block-paragraph">Lines <code>4-6</code> of our code will generate this list of codons:</p>


<div class="wp-block-codemirror-blocks-code-block code-block"><pre class="CodeMirror" data-setting="{&quot;showPanel&quot;:true,&quot;languageLabel&quot;:&quot;language&quot;,&quot;fullScreenButton&quot;:true,&quot;copyButton&quot;:true,&quot;mode&quot;:&quot;javascript&quot;,&quot;mime&quot;:&quot;application/json&quot;,&quot;theme&quot;:&quot;monokai&quot;,&quot;lineNumbers&quot;:true,&quot;styleActiveLine&quot;:false,&quot;lineWrapping&quot;:false,&quot;readOnly&quot;:true,&quot;fileName&quot;:&quot;JSON&quot;,&quot;language&quot;:&quot;JSON&quot;,&quot;maxHeight&quot;:&quot;400px&quot;,&quot;modeName&quot;:&quot;json&quot;}">['TTG', 'CTA', 'CTT', 'CTT']</pre></div>


<p class="wp-block-paragraph">and store it in <code>tmpList</code> (temporary list).<br><br>We can see that <code>'L'</code> (Leu/Leucine) is present 4 times (marked in bold):</p>



<p class="wp-block-paragraph">|<code><strong>TTG</strong>|<strong>CTA</strong>|GGA|TGA|GTC|GCG|AGG|TTT|<strong>CTT</strong>|CAC|GCC|TTT|<strong>CTT</strong>|AGT|GAC|TGG|TA</code></p>



<p class="wp-block-paragraph">Based on that, line <code>8</code> will create a dictionary that looks like this:</p>


<div class="wp-block-codemirror-blocks-code-block code-block"><pre class="CodeMirror" data-setting="{&quot;showPanel&quot;:true,&quot;languageLabel&quot;:&quot;language&quot;,&quot;fullScreenButton&quot;:true,&quot;copyButton&quot;:true,&quot;mode&quot;:&quot;javascript&quot;,&quot;mime&quot;:&quot;application/json&quot;,&quot;theme&quot;:&quot;monokai&quot;,&quot;lineNumbers&quot;:true,&quot;styleActiveLine&quot;:false,&quot;lineWrapping&quot;:false,&quot;readOnly&quot;:true,&quot;fileName&quot;:&quot;JSON&quot;,&quot;language&quot;:&quot;JSON&quot;,&quot;maxHeight&quot;:&quot;400px&quot;,&quot;modeName&quot;:&quot;json&quot;}">{'TTG': 1, 'CTA': 1, 'CTT': 2}</pre></div>


<p class="wp-block-paragraph">This is because there are six different codons that code for <code>L</code> and we have 3 in our example sequence.</p>



<p class="wp-block-paragraph">Line <code>9</code> will sum up all values (1 + 1 + 2) to get <code>4</code></p>



<p class="wp-block-paragraph">And finally, lines <code>10-11</code> will loop through that <code>freqDict</code> (frequencies dictionary)  and divide all values by <code>4</code>. Now, our dictionary will look like this:</p>


<div class="wp-block-codemirror-blocks-code-block code-block"><pre class="CodeMirror" data-setting="{&quot;showPanel&quot;:true,&quot;languageLabel&quot;:&quot;language&quot;,&quot;fullScreenButton&quot;:true,&quot;copyButton&quot;:true,&quot;mode&quot;:&quot;javascript&quot;,&quot;mime&quot;:&quot;application/json&quot;,&quot;theme&quot;:&quot;monokai&quot;,&quot;lineNumbers&quot;:true,&quot;styleActiveLine&quot;:false,&quot;lineWrapping&quot;:false,&quot;readOnly&quot;:true,&quot;fileName&quot;:&quot;JSON&quot;,&quot;language&quot;:&quot;JSON&quot;,&quot;maxHeight&quot;:&quot;400px&quot;,&quot;modeName&quot;:&quot;json&quot;}">{'TTG': 0.25, 'CTA': 0.25, 'CTT': 0.5}</pre></div>


<hr class="wp-block-separator has-css-opacity"/>



<p class="wp-block-paragraph">Alright. Let&#8217;s add two more outputs to our <code>main.py</code> file:</p>


<div class="wp-block-codemirror-blocks-code-block code-block"><pre class="CodeMirror" data-setting="{&quot;showPanel&quot;:true,&quot;languageLabel&quot;:&quot;language&quot;,&quot;fullScreenButton&quot;:true,&quot;copyButton&quot;:true,&quot;mode&quot;:&quot;python&quot;,&quot;mime&quot;:&quot;text/x-python&quot;,&quot;theme&quot;:&quot;monokai&quot;,&quot;lineNumbers&quot;:true,&quot;styleActiveLine&quot;:false,&quot;lineWrapping&quot;:false,&quot;readOnly&quot;:true,&quot;fileName&quot;:&quot;Python&quot;,&quot;align&quot;:&quot;wide&quot;,&quot;language&quot;:&quot;Python&quot;,&quot;maxHeight&quot;:&quot;400px&quot;,&quot;modeName&quot;:&quot;python&quot;}">print(
    f'[7] + Aminoacids Sequence from DNA: {translate_seq(DNAStr, 0)}
')

print(
    f'[8] + Codon frequency (L): {codon_usage(DNAStr, &quot;L&quot;)}
')</pre></div>


<p class="wp-block-paragraph">If we run everything we programmed so far, we should see something like this:</p>


<div class="wp-block-codemirror-blocks-code-block code-block"><pre class="CodeMirror" data-setting="{&quot;showPanel&quot;:true,&quot;languageLabel&quot;:&quot;language&quot;,&quot;fullScreenButton&quot;:true,&quot;copyButton&quot;:true,&quot;mode&quot;:&quot;python&quot;,&quot;mime&quot;:&quot;text/x-python&quot;,&quot;theme&quot;:&quot;monokai&quot;,&quot;lineNumbers&quot;:true,&quot;styleActiveLine&quot;:false,&quot;lineWrapping&quot;:false,&quot;readOnly&quot;:true,&quot;align&quot;:&quot;wide&quot;,&quot;fileName&quot;:&quot;Python&quot;,&quot;language&quot;:&quot;Python&quot;,&quot;maxHeight&quot;:&quot;400px&quot;,&quot;modeName&quot;:&quot;python&quot;}">Sequence: TCTCCTCTACGATCTATGTTTTTTTATAAGTGCCTCCTAGACTTACTCCG

[1] + Sequence Length: 50

[2] + Nucleotide Frequency: {'A': 9, 'C': 14, 'G': 6, 'T': 21}

[3] + DNA/RNA Transcription: UCUCCUCUACGAUCUAUGUUUUUUUAUAAGUGCCUCCUAGACUUACUCCG

[4] + DNA String + Complement + Reverse Complement:
5' TCTCCTCTACGATCTATGTTTTTTTATAAGTGCCTCCTAGACTTACTCCG 3'
   ||||||||||||||||||||||||||||||||||||||||||||||||||
3' AGAGGAGATGCTAGATACAAAAAAATATTCACGGAGGATCTGAATGAGGC 5' [Complement]
5' CGGAGTAAGTCTAGGAGGCACTTATAAAAAAACATAGATCGTAGAGGAGA 3' [Rev. Complement]

[5] + GC Content: 40%

[6] + GC Content in Subsection k=5: [60, 40, 40, 20, 0, 20, 60, 60, 20, 80]

[7] + Aminoacids Sequence from DNA: ['S', 'P', 'L', 'R', 'S', 'M', 'F', 'F', 'Y', 'K', 'C', 'L', 'L', 'D', 'L', 'L']

[8] + Codon frequency (L): {'CTA': 0.4, 'CTC': 0.4, 'TTA': 0.2}</pre></div>


<p class="wp-block-paragraph">That&#8217;s it for this article. Please feel free to leave any questions below or join our bioinformatics community in Telegram and Matrix.</p>



<p class="wp-block-paragraph">Source code for this lesson is available here:<br><a href="https://github.com/rebelC0der/DNA_Toolkit" target="_blank" rel="noreferrer noopener">https://github.com/rebelC0der/DNA_Toolkit</a></p>



<p class="wp-block-paragraph">Here is a video version of this article:</p>



<figure class="wp-block-embed is-type-video is-provider-youtube wp-block-embed-youtube wp-embed-aspect-16-9 wp-has-aspect-ratio"><div class="wp-block-embed__wrapper">
<iframe loading="lazy" title="Bioinformatics in Python: DNA Toolkit. Part 5: Open Reading Frames" width="640" height="360" src="https://www.youtube.com/embed/8xDdJl9dYHg?feature=oembed" frameborder="0" allow="accelerometer; autoplay; clipboard-write; encrypted-media; gyroscope; picture-in-picture; web-share" referrerpolicy="strict-origin-when-cross-origin" allowfullscreen></iframe>
</div></figure>
]]></content:encoded></item><item><title>Want to get into programming or bioinformatics but not sure where to start?</title><link>https://rebelscience.club/2020/03/want-to-get-into-programming-or-bioinformatics-but-not-sure-where-to-start/</link><guid isPermaLink="true">https://rebelscience.club/2020/03/want-to-get-into-programming-or-bioinformatics-but-not-sure-where-to-start/</guid><pubDate>Sat, 28 Mar 2020 15:36:11 GMT</pubDate><description>Thoughts on the classic question: “Where should I start as a beginner and how do I choose a project?”
</description><content:encoded><![CDATA[<div class="wp-block-image is-style-default">
<figure class="aligncenter is-resized"><a href="https://miro.medium.com/max/640/0*hmPzPbKDJFpPYS1d.jpg"><img decoding="async" src="https://miro.medium.com/max/640/0*hmPzPbKDJFpPYS1d.jpg" alt="" width="572" height="223"/></a><figcaption class="wp-element-caption">Click to enlarge/download</figcaption></figure>
</div>


<p class="wp-block-paragraph">Throughout the years, I have had a lot of people asking me exactly the same question:</p>



<blockquote class="wp-block-quote is-layout-flow wp-block-quote-is-layout-flow"><p>“I  have a basic knowledge of [programming language]. I am looking for some sample/starter projects to work on in [insert a field]. Please  suggest”.</p></blockquote>



<p class="wp-block-paragraph">The
 “insert a field” part can be anything. In my case, it was C++, Python, 
OpenGL, game engines, embedded systems and now, bioinformatics.</p>



<p class="wp-block-paragraph">Below are my thoughts and reasons on why it is very hard to recommend a project, especially in Bioinformatics.</p>



<hr class="wp-block-separator has-css-opacity"/>



<p class="wp-block-paragraph">You
 need to know and understand why you want to do “this”, otherwise, it 
will be very hard, or even impossible to progress and achieve anything. 
If a person got into Bioinformatics or any other subject, they probably 
got into it for a specific reason. Let’s say you watched a video or read
 an article about <a href="https://www.youtube.com/watch?v=D1H6NsRTlH0" target="_blank" rel="noreferrer noopener">Michael Levin’s</a>
 research where he talks about Cell signaling and Cell information 
transfer for tissue/organ regeneration. It got you very interested and 
excited to look into that more. Being able to look at organisms that 
have the ability (genes turned on) to regenerate, and finding genes that
 allow for that, sounds amazing, right?</p>



<p class="wp-block-paragraph">You  are thinking that being able to help people to grow back limbs, eyes or  any other parts of the body is amazing, and it is possible as per  Michel’s latest research. That can be a good reason to get into Biology,  Genomics and Data Science/Programming. If you think that  biology/programming is just cool and maybe a good career salary-wise, it  might be extremely challenging to achieve anything as you will be  constantly stuck in “I have a basic knowledge of X, please recommend a  project in Y” scenario. I see people fail again and again, when they are  trying to pick up a new skill without a good reason. Having a  supportive community and mentor-friends is super important too.</p>



<hr class="wp-block-separator has-css-opacity"/>



<p class="wp-block-paragraph">Perhaps  you are a biologist, and you want to learn some Data Science and  programming to be able to use and write software to help you make sense  of your biology/lab data. Of course, you could instead pass this data  along to a computer scientist and wait for them to provide you with the  results. What if the results are not correct due to the computer  scientist not fully understanding the basics/fundamentals of biology?  Well, you have to write documentation to provide alongside your  laboratory data.</p>



<p class="wp-block-paragraph">If  you have a good understanding of Biology and want to add programming to  your set of skills, it is important to know that there are amazing,  free, and open-source tools to help biologists already. Do you really  need to learn how to program in your situation? Of course programming  can be a lot of fun, but knowing the basics of some programming language  is not the same thing as having a good understanding of computer  science, data structures, memory management and just how to write good,  efficient code and well-structured code that is easy to maintain. Huge classes, inheriting from each other, might get out of hand very quickly  if you don’t have code structuring skills.</p>



<p class="wp-block-paragraph">Basics  in, say, Python is not the same as having a good understanding of  Python and how to write good code. The difference between an okay code  and a good optimized code, that is written with a good understanding of  what you are doing, especially in biology, is that your code either runs  10 seconds or 10 days. A good example would be: searching for motifs in  a DNA/RNA string, with point mutations. You just have to know what  algorithms exist and how and when to use them. If you write a few naive  ‘for loops’ in Python, that solution will not scale well to large  datasets.</p>



<hr class="wp-block-separator has-css-opacity"/>



<p class="wp-block-paragraph">So
 again, the basics of Python is not the same as knowing Python, data 
structures, and algorithms. It all takes time to master. You just have 
to have good fundamentals of the field you are trying to solve/help to 
solve problems in. Only then, armed with with this knowledge, you can 
focus on and dive deep into a very specific subject, otherwise you will 
not be able to tackle any serious problems. A good example is; you have 
to know basic math, like Vectors, Matrices, and angle calculations to be
 able to work on computer graphics. Being a good programmer alone, 
without a good understanding of basic math, won’t let you solve computer
 graphics problems. You need math.</p>



<p class="wp-block-paragraph">Another example:</p>



<blockquote class="wp-block-quote is-layout-flow wp-block-quote-is-layout-flow"><p>“I
 am working on a basic DNA nucleotide count code, DNA into RNA 
transcription, but I want to work on a full scale project, maybe 
multi-omics data analysis, or something?”.</p></blockquote>



<p class="wp-block-paragraph">You need to be able to program and understand many fundamental concepts before you can even tackle problems like that.</p>



<p class="wp-block-paragraph">As the legendary Michael Abrash said:</p>



<blockquote class="wp-block-quote is-layout-flow wp-block-quote-is-layout-flow"><p>“…there are a lot of problems you can’t tackle any other way”.</p></blockquote>



<p class="wp-block-paragraph">This
 means that knowing the fundamentals of the field you are working in is 
imperative to avoid “reinventing a (slow/bad) wheel”.</p>



<p class="wp-block-paragraph">He has a very good response to the classic, “where to start” question here (the whole interview is amazing, but the answer at <a rel="noreferrer noopener" href="https://youtu.be/l461vIVtDZM?t=231" target="_blank">3:52</a> mark is more relevant to this article):</p>



<figure class="wp-block-embed aligncenter is-type-video is-provider-youtube wp-block-embed-youtube wp-embed-aspect-16-9 wp-has-aspect-ratio"><div class="wp-block-embed__wrapper">
<iframe loading="lazy" title="Pipeline Interviews: Michael Abrash on Virtual Reality &amp; the Future of Gaming" width="640" height="360" src="https://www.youtube.com/embed/l461vIVtDZM?feature=oembed" frameborder="0" allow="accelerometer; autoplay; clipboard-write; encrypted-media; gyroscope; picture-in-picture; web-share" referrerpolicy="strict-origin-when-cross-origin" allowfullscreen></iframe>
</div></figure>



<p class="wp-block-paragraph">An amazing programmer, Ken Silverman, was the creator of Build Engine that  powered iconic games like Duke Nukem 3D, Shadow Warrior, and Blood. He  once replied to my “where to start” question with this:</p>



<blockquote class="wp-block-quote is-layout-flow wp-block-quote-is-layout-flow"><p>“These three things are the basis for a good programmer”</p><p>1) Full understanding of a programming language syntax and libraries.<br>2) Good understanding of all the basic algorithms and data structure and different permutations of them.<br>3)  Knowledge and understanding of which algorithm and which data structure  to use in certain situations (this can only be obtained by writing a  lot of code, reading books and looking at others’ code).</p></blockquote>



<p class="wp-block-paragraph">It seems that the easiest case is when a programmer is interested in  switching to bioinformatics. Point 1 still applies here. You have to  have a reason why, otherwise you will keep asking “what can I do, how  can I help” and this will look like you have no clue why you are doing  this and people will probably not collaborate with you. This applies to  anything you will want to collaborate with other people on.</p>



<p class="wp-block-paragraph">If  you as a programmer are getting into biology, you probably already know  why and what code needs to be written to solve certain problems. In  this case, you know what to work on and what to study. It is also easier  for programmers as you don’t really need a super-deep understanding of  biology as long as you have a good description of a problem that needs  to be solved, supplemented with sample inputs and outputs to test your  code.</p>



<h3 class="wp-block-heading">What do I suggest?</h3>


<div class="wp-block-image">
<figure class="aligncenter is-resized"><a href="https://miro.medium.com/max/1021/1*hKMu0JzalBwWw3bXsnLxJg.png"><img decoding="async" src="https://miro.medium.com/max/1021/1*hKMu0JzalBwWw3bXsnLxJg.png" alt="" width="626" height="312"/></a><figcaption class="wp-element-caption">Click to enlarge/download</figcaption></figure>
</div>


<p class="wp-block-paragraph">If  you are proficient in one of the fields, and you want to pick up a new  skill, you probably have already learned how to learn. Picking up a new  skill should not be a problem in your case.</p>



<p class="wp-block-paragraph">If
 you are a total beginner, I always suggest picking up a new skill from 
at least two sources. It can be any combination of the following; books,
 online courses, YouTube videos, articles. It is okay even if they cover
 only mostly the same material. Learning from one source and reinforcing
 your understanding with another will make sure you have grasped the 
material. Alongside study materials, you should be solving problems on 
websites like Hacker Rank, Project Euler or Rosalind. This will also be a
 part of your new portfolio.</p>



<p class="wp-block-paragraph">Progressing
 through these sources will allow you to establish a good fundamental 
knowledge of a subject. A few days in you will be hooked and reach 
so-called “learning escape velocity” or give up and move on.</p>



<hr class="wp-block-separator has-css-opacity"/>



<p class="wp-block-paragraph">For bioinformatics specifically, I have the following for you to try, no matter if you are a biologist or a programmer:</p>



<ul class="wp-block-list"><li>Sign up for this free, 4 Week/Module Coursera course: <a href="https://www.coursera.org/learn/bioinformatics" target="_blank" rel="noreferrer noopener">Link</a> and start learning. It covers both biology for programmers and programming for biologists.</li><li>Get any “Bioinformatics in Python” book.</li><li>Start working away on both, while trying to solve HackerRank/Rosalind problems.</li></ul>



<p class="wp-block-paragraph">You  will be surprised by how many people give up after the first week of  this course. I completed this particular course a while ago, and I saw  the number of people in the comments&#8217; section drop dramatically as the  course progressed from week 1 to week 4, and very few people completed  it, compared to the number of people who joined the course. My  estimation would be 5 out of 200 people manage to finish this course.  And remember, it is just an introductory course. Trying this course  alone will give you a good idea if your “basics of language X” and/or  “basics of biology” are enough to work on any project that you are  asking others to suggest to you. You will also see how complex it might  get even on a very basic level.</p>



<p class="wp-block-paragraph">Following
 the three steps I listed above, will also give you a very clear answer 
to the questions of “I have the basics, what can I do” as they will 
reference and point you into the direction of other resources and 
projects you can pick up upon completing a course/book.</p>



<p class="wp-block-paragraph">The  above statements are just my opinions, based on my experience. This is  intended to be a dynamic article, as opinions and experiences of other  people, as well as mine, can and probably will affect it. Edits of this  article will be clearly marked.</p>



<h3 class="wp-block-heading" id="3ead">To sum it up</h3>



<p class="wp-block-paragraph">You  have to know why you want to learn programming as a biologist and  understand that having the basics of some programming language are  definitely not enough. As a programmer, you have to have a reason why  you want to do computational biology. In both cases, ask yourself: why  do I want to do this, what made me want to switch to a new field, or add  a new skill to my skill set. If you can answer this question, you have  an answer for “what project can I work on”.</p>


<div class="wp-block-image">
<figure class="aligncenter"><a href="https://miro.medium.com/max/1200/0*0mglNnBkceLu-bTu.jpg"><img decoding="async" src="https://miro.medium.com/max/1200/0*0mglNnBkceLu-bTu.jpg" alt=""/></a><figcaption class="wp-element-caption">Click to enlarge/download</figcaption></figure>
</div>


<p class="wp-block-paragraph">If you have any suggestions and/or comments, feel free to join our Bioinformatics telegram channel: <a rel="noreferrer noopener" href="https://t.me/biocodex" target="_blank">https://t.me/biocodex</a></p>
]]></content:encoded></item></channel></rss>